Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MLH1

Gene ID (NCBI) 4292
Gene Symbol MLH1
Protein Name mutL homolog 1
Synonyms COCA2|FCC2|HNPCC|HNPCC2|hMLH1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03345 AxCAhMLH1WT (forward) Recombinant adenovirus harboring human MLH1 cDNA

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001488 IRAK003L24 pCMV-SPORT6 BC006850 NM_000249 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173297 ARi33E01 pGCAP10 NM_000249.2  
GGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATG
HKR235013 ARiS087I21 pGCAP10 NM_000249.2  
HKR405665 RBdS014C17 pGCAP10 NM_000249.2 done
GGATTGGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl