Prev. |  Human A to Z list >  M >  MLH1 > 

RBdS014C17 - NRCD Human cDNA Clone

Catalog Number HKR405665
Clone Name RBdS014C17
Clone info. Plasmid clone of human MLH1 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGATTGGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_000249.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) MLH1 (NCBI Gene 4292)  other clone of MLH1 in our bank
Synonyms COCA2|FCC2|HNPCC|HNPCC2|hMLH1
Protein Name mutL homolog 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR405665 RBdS014C17 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBdS014C17a.seq   RBdS014C17c.seq   RBdS014C17.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_RB_210404.csv - GNP_filter3_NRCD_html_190131.pl