Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAT2A

Gene ID (NCBI) 4144
Gene Symbol MAT2A
Protein Name methionine adenosyltransferase 2A
Synonyms MATA2|MATII|SAMS2
Databases KEGG hsa:4144 |  NCBI Gene 4144
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00789)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07393 pGL4-phMAT2A Promoter collection, Human MAT2A promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081372 IRAL003H04 pOTB7 BC001686 NM_005911 Full
HGY084356 IRAL010O20 pOTB7 BC001854 NM_005911 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113637 M01C084B13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113685 M01C084D13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113733 M01C084F13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113781 M01C084H13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113829 M01C084J13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113877 M01C084L13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113925 M01C084N13 pDONR221 IMS05-G07 BC001686 NM_005911  
HGE113973 M01C084P13 pDONR221 IMS05-G07 BC001686 NM_005911  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048101 ARe20E05 pKA1U5 NM_005911.4  
TGGGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATT
HKR338478 RBb46D06 pGCAP1 NM_005911.4  
HKR342502 RBb56E06 pGCAP1 NM_005911.4  
GGGTTCGCATCCACGACCGCCCCGCCTGCTACGAAGATAGGAACGCTGTTCCGCAGCTTG
HKR360476 RBd01D04 pGCAP10 NM_005911.4  
GGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR373325 RBd33F05 pGCAP10 NM_005911.4  
HKR375756 RBd39G12 pGCAP10 NM_005911.4  
GGTTCGCTCCACGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR377675 RBd44D03 pGCAP10 NM_005911.4  
GGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR377700 RBd44E04 pGCAP10 NM_005911.4  
GGTTCGCTCCACGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR397303 RBd93E07 pGCAP10 NM_005911.4  
GGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR416370 RBdS040P10 pGCAP10 NM_005911.4  
GGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
HKR433364 RBdS083G20 pGCAP10 NM_005911.4  
NNNNNNNTCCNCNCCNCCCGCCTGCTACTAGTAGAACGCTGTCCGCAGCTTGCGCATTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl