Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040P10

Clone ID RBdS040P10
HP ID HP04919
Gene ID 4144
Gene Symbol MAT2A
Protein Name methionine adenosyltransferase II, alpha
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005911.4
Length of RefSeq (bp) 2835
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.516157
5'-terminal sequence GGTTCGCTCCGCGCCGCCCGCCTGCTACGAGTAGAACGCTGTCCGCAGCTTGCGCATTTC
2011.08.28