Prev. |  KEGG KO K18743 > 

RIKEN DNA Bank Human Resource - CAPRIN1

Gene ID NCBI Gene 4076 |  KEGG hsa:4076
Gene Symbol CAPRIN1
Protein Name cell cycle associated protein 1
Synonyms GPIAP1|GPIP137|GRIP137|M11S1|RNG105|p137GPI
Ortholog resources KEGG ortholog (KEGG orthology K18743) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082493 IRAL006D21 pOTB7 BC001731 NM_005898 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097231 M01C043B07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097279 M01C043D07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097327 M01C043F07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097375 M01C043H07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097423 M01C043J07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097471 M01C043L07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097519 M01C043N07 pDONR221 MGC11-C04 BC001731 ENST00000257845  
HGE097567 M01C043P07 pDONR221 MGC11-C04 BC001731 ENST00000257845  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168827 ARi22B03 pGCAP10 NM_005898.4  
GACTAGGAGCGGCTCTCGGTGCAGCGGGACAGGGCGAAGCGGCCTGCGCCCACGGAGCGC
HKR180427 ARi51B03 pGCAP10 NM_005898.4  
GCCCGCGTCTCGCCCCGTCCGTCTCCTGACTGGCCGCTCTTGTCCTTCCTCCCGCTTTTT
HKR420529 RBdS051F09 pGCAP10 NM_005898.4  
GGCCCCTCGCGACCCAGAGGGCTGCTGGCTGGCTAAGTCCCTCCCGCTCCCGGCTCTCGC
HKR444101 RBdS110E05 pGCAP10 NM_005898.4  
GCTCGCCTCACTAGGAGCGGCTCTCGGTGCAGCGGGACAGGGCGAAGCGGCCTGCGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl