Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110E05

Clone ID RBdS110E05
HP ID HP06344
Gene ID 4076
Gene Symbol CAPRIN1
Protein Name cell cycle associated protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005898.4
Length of RefSeq (bp) 5562
Chromosome 11p13
Reference DDBJ accession
UniGene Hs.471818
5'-terminal sequence GCTCGCCTCACTAGGAGCGGCTCTCGGTGCAGCGGGACAGGGCGAAGCGGCCTGCGCCCA
2011.08.28