Prev. |  KEGG KO K06830 > 

RIKEN DNA Bank Human Resource - LGALS1

Gene ID NCBI Gene 3956 |  KEGG hsa:3956
Gene Symbol LGALS1
Protein Name galectin 1
Synonyms GAL1|GBP
Featured content Lectin - human
Ortholog resource in our bank

  LGALS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04217 pGEX-G1-1a Bacteria expression vector of human galectin-1, GST fusion protein
RDB08392 pET-G1-1a Bacteria expression vector of human galectin-1, tag-free protein
RDB08448 pGEX-CSG1-2a Bacteria expression vector of human galectin-1 in which all Cys residues are substituted with Ser residues (G1C3,17,43,61,89,131S: CSG1), GST fusion protein
RDB08449 pET-CSG1-1a Bacteria expression vector of human galectin-1 in which all Cys residues are substituted with Ser residues (G1C3,17,43,61,89,131S: CSG1), tag-free protein

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094925 IRAL037F05 pDNR-LIB BC020675 NM_002305 Full
HGY081315 IRAL003E19 pOTB7 BC001693 NM_002305 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004105 W01A010E09 pENTR-TOPO IRAL003E19 BC001693 NM_002305  
HGE004107 W01A010E11 pENTR-TOPO IRAL003E19 BC001693 NM_002305  
HGE004109 W01A010E13 pENTR-TOPO IRAL003E19 BC001693 NM_002305  
HGE004111 W01A010E15 pENTR-TOPO IRAL003E19 BC001693 NM_002305  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040977 ARe02H09 pKA1U5 NM_002305.3  
GCTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGCTGCNCCTGCCCGGGAACATCCTCCTG
HKR043610 ARe09A10 pKA1U5 NM_002305.3  
ATCCTGATCTCTCTCGGGCTGGANTCTTCTGACNCCTGGGTGCGNCATGCCCGGGAAACA
HKR045654 ARe14C06 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR045702 ARe14E06 pKA1U5 NM_002305.3  
GTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACT
HKR048078 ARe20D06 pKA1U5 NM_002305.3  
TGCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR049209 ARe23A09 pKA1U5 NM_002305.3  
GCTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR052409 ARe31A09 pKA1U5 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR052828 ARe32B04 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR053208 ARe33A08 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR054525 ARe36F05 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR055378 ARe38H10 pKA1U5 NM_002305.3  
GTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCNCCTGCCCGGGAACATCCTCCTGGA
HKR058433 ARe46B09 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR059674 ARe49D02 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR060478 ARe51D06 pKA1U5 NM_002305.3  
GCTCTCAGGCGGTAATCTTCTATACAGTTGGCTGACGCCCTGCCCGNAAACATCCTCCTG
HKR062147 ARe55G03 pKA1U5 NM_002305.3  
GNCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCCCNTTGACNCGGGAACATCCTCCTGGA
HKR062425 ARe56B01 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGNCCCCTTTNAACCGGGAACATCCTCCTGG
HKR062802 ARe57A02 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR063769 ARe59H01 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR066081 ARe65D09 pKA1U5 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR068457 ARe71C09 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR068952 ARe72G08 pKA1U5 NM_002305.3  
GTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGNCTGCCCGGGAACATCCTCCTGGA
HKR069730 ARe74F10 pKA1U5 NM_002305.3  
GCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTC
HKR071635 ARe79B11 pKA1U5 NM_002305.3  
GTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR074808 ARe87A08 pKA1U5 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR074881 ARe87D09 pKA1U5 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR074904 ARe87E08 pKA1U5 NM_002305.3  
GCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTC
HKR075603 ARe89A03 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR078572 ARe96H04 pKA1U5 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR079604 ARe99A04 pKA1U5 NM_002305.3  
GCTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR080508 ARf01E12 pKA1U5 NM_002305.3  
GCTCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR162012 ARi05A12 pGCAP10 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCNCGGGACATCCTCCTGGA
HKR164852 ARi12C04 pGCAP10 NM_002305.3  
TTGCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR165253 ARi13C05 pGCAP10 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR165703 ARi14E07 pGCAP10 NM_002305.3  
TGACCCGGTCCGGTCCAGTTAAAAGGGTGGGAGCGTCCGGGGGCCCATCTCTCTCGGGTG
HKR167700 ARi19E04 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR168453 ARi21C05 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR172172 ARi30H04 pGCAP10 NM_002305.3  
GCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTC
HKR176804 ARi42A04 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR177727 ARi44F07 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR179277 ARi48D05 pGCAP10 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR180177 ARi50H09 pGCAP10 NM_002305.3  
GCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTC
HKR181602 ARi54A02 pGCAP10 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR182827 ARi57B03 pGCAP10 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR184036 ARi60B12 pGCAP10 NM_002305.3  
CGGCCGGCCGATGCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGA
HKR186801 ARi67A01 pGCAP10 NM_002305.3  
TGTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR187722 ARi69F02 pGCAP10 NM_002305.3  
ATGTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR208086 ARiS020D14 pGCAP10 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR208211 ARiS020I19 pGCAP10 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR208280 ARiS020L16 pGCAP10 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR208282 ARiS020L18 pGCAP10 NM_002305.3  
GGCNCNNNNCGGAGTGTCCCTGTNAGNGNNNCTCCGCCCGNNANGGNNGNNNNNCGGGGA
HKR209290 ARiS023D18 pGCAP10 NM_002305.3  
ATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGA
HKR219755 ARiS049G11 pGCAP10 NM_002305.3  
GGGTACAAGGAGAATCCGGAAACAGCGGGCTGGGGCNNCCNCTGCTTACNCTGNNNANGG
HKR219837 ARiS049J21 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR234207 ARiS085I15 pGCAP10 NM_002305.3  
HKR238655 ARiS096K15 pGCAP10 NM_002305.3  
TGGATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCT
HKR247360 ARiS118G16 pGCAP10 NM_002305.3  
GATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGG
HKR276642 ARiS191K02 pGCAP10 NM_002305.3  
TTATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTG
HKR276678 ARiS191L14 pGCAP10 NM_002305.3  
GCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR279229 ARiS198B05 pGCAP10 NM_002305.3  
NGTCTCTCGGGNGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGAC
HKR416098 RBdS040E02 pGCAP10 NM_002305.3  
GGGGGCTCACCCGGTCCGGTCCAGTTAAAAGGGTGGGAGCGTCCGGGGGCCCATCTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl