Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040E02

Clone ID RBdS040E02
HP ID HP00461
Gene ID 3956
Gene Symbol LGALS1
Protein Name lectin, galactoside-binding, soluble, 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002305.3
Length of RefSeq (bp) 586
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.445351
5'-terminal sequence GGGGGCTCACCCGGTCCGGTCCAGTTAAAAGGGTGGGAGCGTCCGGGGGCCCATCTCTCT
2011.08.28