Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LDHA

Gene ID (NCBI) 3939
Gene Symbol LDHA
Protein Name lactate dehydrogenase A
Synonyms GSD11|HEL-S-133P|LDH1|LDHM
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00016)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY100498 IRAL051E02 pDNR-LIB BC067223 NM_005566 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040926 ARe02F06 pKA1U5 NM_005566.3 done
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR042457 ARe06C09 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR043608 ARe09A08 pKA1U5 NM_005566.3  
GGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR161625 ARi04B01 pGCAP10 NM_005566.3 done
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR161730 ARi04F10 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR162479 ARi06D07 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR162902 ARi07E06 pGCAP10 NM_005566.3  
GATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAG
HKR044006 ARe10A06 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR044899 ARe12E03 pKA1U5 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGNCACGCGCCCCCGACGACCGCCCG
HKR045607 ARe14A07 pKA1U5 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR046011 ARe15A11 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR046579 ARe16H11 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR165283 ARi13D11 pGCAP10 NM_005566.3  
GCTCATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCC
HKR166107 ARi15E11 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR048425 ARe21B01 pKA1U5 NM_005566.3  
GAGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACC
HKR050876 ARe27D04 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCCCNTTGAACACGCGCCCCCGACGACCGC
HKR050902 ARe27E06 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR169276 ARi23D04 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR169722 ARi24F02 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR169770 ARi24H02 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR170412 ARi26A12 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR170831 ARi27B07 pGCAP10 NM_005566.3  
GAGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACC
HKR171273 ARi28D01 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR052406 ARe31A06 pKA1U5 NM_005566.3  
GGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR054460 ARe36C12 pKA1U5 NM_005566.3  
GGTGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR054977 ARe37H09 pKA1U5 NM_005566.3  
AGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR055230 ARe38B06 pKA1U5 NM_005566.3  
GGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAGTCCAATATGGCAACTC
HKR055625 ARe39B01 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR173370 ARi33H02 pGCAP10 NM_005566.3  
TTCGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGAC
HKR174026 ARi35B02 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR174455 ARi36C07 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR059751 ARe49G07 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR176953 ARi42G09 pGCAP10 NM_005566.3  
GAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR179748 ARi49G04 pGCAP10 NM_005566.3  
GAGCTGTTCCACTTAAGGCCCCTCCCGCGCCCAGCTCAGAGTGCTGCAGCCGCTGCCGCC
HKR060809 ARe52A09 pKA1U5 NM_005566.3  
TGGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCC
HKR060899 ARe52E03 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR062057 ARe55C09 pKA1U5 NM_005566.3  
ATCCTGGGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGA
HKR180927 ARi52F07 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR182004 ARi55A04 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR065732 ARe64F12 pKA1U5 NM_005566.3  
GAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR066928 ARe67F08 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR184079 ARi60D07 pGCAP10 NM_005566.3  
TGGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR184976 ARi62H08 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR185282 ARi63D10 pGCAP10 NM_005566.3  
CGGCCGGCCGATGGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCC
HKR186498 ARi66E02 pGCAP10 NM_005566.3  
GATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAG
HKR187355 ARi68G11 pGCAP10 NM_005566.3  
CGGCCGGCCGATGAAGGCCCCTCCCGCGCCCAGCTCAGAGTGCTGCAGCCGCTGCCGCCG
HKR187652 ARi69C04 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR068007 ARe70A07 pKA1U5 NM_005566.3  
TGGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR068104 ARe70E08 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR068825 ARe72B01 pKA1U5 NM_005566.3  
ATCCTGATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTT
HKR071329 ARe78F09 pKA1U5 NM_005566.3  
GATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAG
HKR071369 ARe78H01 pKA1U5 NM_005566.3  
GAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR071707 ARe79E11 pKA1U5 NM_005566.3  
GGTGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR072055 ARe80C07 pKA1U5 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR073345 ARe83G01 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR073770 ARe84H02 pKA1U5 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR074548 ARe86G04 pKA1U5 NM_005566.3  
GATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAG
HKR074956 ARe87G12 pKA1U5 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR205503 ARiS013M15 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCNGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR205561 ARiS013P01 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR209421 ARiS023J05 pGCAP10 NM_005566.3  
GGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCC
HKR209430 ARiS023J14 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR209451 ARiS023K11 pGCAP10 NM_005566.3  
GATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAG
HKR218153 ARiS045G09 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR218242 ARiS045K02 pGCAP10 NM_005566.3  
GCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCGA
HKR218384 ARiS045P24 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR219718 ARiS049E22 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR234214 ARiS085I22 pGCAP10 NM_005566.3  
TGGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACC
HKR234909 ARiS087E13 pGCAP10 NM_005566.3  
GGNGNGCANCANCCGCTNCCGCCNATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR234913 ARiS087E17 pGCAP10 NM_005566.3  
HKR238524 ARiS096F04 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR238769 ARiS096P09 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR247241 ARiS118B17 pGCAP10 NM_005566.3  
GAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR260280 ARiS150L16 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR264404 ARiS161A04 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR276511 ARiS191E15 pGCAP10 NM_005566.3  
GTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCC
HKR277628 ARiS194B04 pGCAP10 NM_005566.3  
GGTGCTGCANCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR279230 ARiS198B06 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR279385 ARiS198H17 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR326857 RBb17C09 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR327673 RBb19D01 pKA1U5 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGAATTCCGGATCTCATTGCCACGCGCCCCCGGACGACCG
HKR365351 RBd13G07 pGCAP10 NM_005566.3  
GAGTGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGA
HKR330122 RBb25F02 pGCAP1 NM_005566.3  
ATGGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR331730 RBb29F10 pGCAP1 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR332831 RBb32B07 pGCAP1 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR372125 RBd30F05 pGCAP10 NM_005566.3  
GAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR374849 RBd37C01 pGCAP10 NM_005566.3  
GCTCATTGCCACGCGCCCCCGACGACCGCCCGACGTGCATTCCCGATTCCTTTTGGTTCC
HKR375376 RBd38H08 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR337233 RBb43B09 pGCAP1 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGTATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGC
HKR338008 RBb45A08 pGCAP1 NM_005566.3  
AGAGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG
HKR383202 RBd58A02 pGCAP10 NM_005566.3  
GGCCGGTCGGTTGNCTGGCTGCGCGCGCCACCCGGGCCTCNCCNNNNNNNCGCCTGGCTC
HKR385331 RBd63F11 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR390049 RBd75C01 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR393658 RBd84C10 pGCAP10 NM_005566.3  
GGCCGGTCGGTTGTCTGGCTGCGCGCGCCACCCGGGCCTCTCCAGTGCCCCGCCTGGCTC
HKR397229 RBd93B05 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR405911 RBdS014M23 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR406278 RBdS015L14 pGCAP10 NM_005566.3  
GGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCCCG
HKR430120 RBdS075E24 pGCAP10 NM_005566.3  
GGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCGCC
HKR444113 RBdS110E17 pGCAP10 NM_005566.3  
GGTGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl