Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LAMP1

Gene ID (NCBI) 3916
Gene Symbol LAMP1
Protein Name lysosomal associated membrane protein 1
Synonyms CD107a|LAMPA|LGP120
Databases KEGG hsa:3916 |  NCBI Gene 3916
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06528)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086854 IRAL017C06 pOTB7 BC006345 NM_005561 Partial/var
HGY088162 IRAL020G18 pOTB7 BC007845 NM_005561 Partial/var
HGY095911 IRAL039M23 pOTB7 BC021288 NM_005561 Partial/var

(1) Please refer Vector Information and Library Method Overviews at MGC.
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113646 M01C084B22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113694 M01C084D22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113742 M01C084F22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113790 M01C084H22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113838 M01C084J22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113886 M01C084L22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113934 M01C084N22 pDONR221 IMS05-H11 BC021288 ENST00000332556  
HGE113982 M01C084P22 pDONR221 IMS05-H11 BC021288 ENST00000332556  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049705 ARe24E09 pKA1U5 NM_005561.3  
TGCGCGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCTCTTGCGTCTGGTAACGC
HKR059228 ARe48B04 pKA1U5 NM_005561.3  
GGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCT
HKR076545 ARe91G01 pKA1U5 NM_005561.3  
GGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCT
HKR161776 ARi04H08 pGCAP10 NM_005561.3  
GGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGC
HKR176057 ARi40C09 pGCAP10 NM_005561.3  
TGGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCTCTTGCGTCTGGTAACGCCGCTGT
HKR187775 ARi69H07 pGCAP10 NM_005561.3  
GGGGATCACGTGACGCCCGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGT
HKR203417 ARiS008J01 pGCAP10 NM_005561.3  
GGTNNNNAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCGCANTGGNNGGGCNN
HKR247237 ARiS118B13 pGCAP10 NM_005561.3  
GGCANTGNNNNGNCCTCTTGCNTNTGGTAACGCCNCTGTCTCTAACGCCAGCCTTTGGCG
HKR381779 RBd54H11 pGCAP10 NM_005561.3  
NTGAANTGANGCCCGGGNGCGGNGCAGCTCACGTGACAAGCGCTGCCGGNNNNGANGTCT
HKR392835 RBd82B11 pGCAP10 NM_005561.3  
GGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCTCTTGCGTCTGGTAACGCCGCT
HKR420602 RBdS051I10 pGCAP10 NM_005561.3  
GGGGATCACGTGACGCCCGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGT
HKR430014 RBdS075A14 pGCAP10 NM_005561.3  
GGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.09.03

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl