Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051I10

Clone ID RBdS051I10
HP ID HP00111
Gene ID 3916
Gene Symbol LAMP1
Protein Name lysosomal-associated membrane protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005561.3
Length of RefSeq (bp) 2560
Chromosome 13q34
Reference DDBJ accession
UniGene Hs.494419
5'-terminal sequence GGGGATCACGTGACGCCCGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGT
2011.08.28