Prev. |  KEGG KO K09404 > 

RIKEN DNA Bank Human Resource - FOXK2

Gene ID NCBI Gene 3607 |  KEGG hsa:3607
Gene Symbol FOXK2
Protein Name forkhead box K2
Synonyms ILF|ILF-1|ILF1|nGTBP
Ortholog resource in our bank

  FOXK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031516 IRAK078N04 pCMV-SPORT6 BC036949 NM_181431 Partial
HGY097620 IRAL044A20 pOTB7 BC041569 NM_181431 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164884 ARi12D12 pGCAP10 NM_004514.3  
GGGTGCGCGGCGGCCGACGACCCGCGCGGCCTGGGCCTCNNCCCGCGCCCCCGGCGCCCG
HKR373700 RBd34E04 pGCAP10 NM_004514.3  
GGCCGCTCGCTCGCTCGCCGGCCGGCGGCCTCGGCTCGGCCCCCTCCCTCAGCTCCGGTG
HKR374503 RBd36E07 pGCAP10 NM_004514.3  
TGCCCCCTCGCCGCCGCTCGCTCGCTCGCCGGCCGGCGGCCTCGGCTCGGCCCCCTCCCT
HKR406063 RBdS015C15 pGCAP10 NM_004514.3  
GGCCGGGGGCGGCGGGTCCCCGCCGGGCGGCTGGGCCGTGGCGCGCCTGGAGGGCCGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl