Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015C15

Clone ID RBdS015C15
HP ID HP06923
Gene ID 3607
Gene Symbol FOXK2
Protein Name forkhead box K2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004514.3
Length of RefSeq (bp) 5262
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.591140
5'-terminal sequence GGCCGGGGGCGGCGGGTCCCCGCCGGGCGGCTGGGCCGTGGCGCGCCTGGAGGGCCGCGA
2011.08.28