Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - ID1

Gene ID (NCBI) 3397
Gene Symbol ID1
Protein Name inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Synonyms ID|bHLHb24
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04680)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03787 SEREX clone NGO-St-008 (ID 15) #1 SEREX clone NGO-St-008 (ID 15) #1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008553 IRAK021G09 pCMV-SPORT6 BC012420 NM_002165 Full
HGY082194 IRAL005I02 pOTB7 BC000613 NM_002165 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021029 W01A052J13 pENTR-TOPO IRAK021G09 BC012420 NM_002165  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052503 ARe31E07 pKA1U5 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR222104 ARiS055E08 pGCAP10 NM_002165.2  
TGATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTT
HKR324056 RBb10C08 pKA1U5 NM_002165.2  
GATTCCACGCTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTT
HKR364922 RBd12F02 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR367231 RBd18B07 pGCAP10 NM_002165.2  
GGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTTTTCGCTT
HKR331630 RBb29B06 pGCAP1 NM_002165.2  
GATTCCACGNTTCTTAACTGNTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTT
HKR368956 RBd22G12 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR370153 RBd25G09 pGCAP10 NM_002165.2  
TATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR335257 RBb38C09 pGCAP1 NM_002165.2  
TGATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTT
HKR374805 RBd37A05 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR336812 RBb42A12 pGCAP1 NM_002165.2  
GAATNCCNCGTTTCGTTAACTGGTTCCATCTTTCCGTTATCTTGCNNCGNGCTTCNACCA
HKR376156 RBd40G12 pGCAP10 NM_002165.2  
TGATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTT
HKR382528 RBd56F08 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCNGGNTTCCACCTCATTTTT
HKR344429 RBb61B05 pGCAP1 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR345371 RBb63H03 pGCAP1 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR390532 RBd76F12 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR390977 RBd77H09 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR391684 RBd79D12 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR405349 RBdS013G05 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR409012 RBdS022I20 pGCAP10 NM_002165.2  
TTTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTTT
HKR416249 RBdS040K09 pGCAP10 NM_002165.2  
GCATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTT
HKR416334 RBdS040N22 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR428042 RBdS070B18 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR428277 RBdS070L13 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR432599 RBdS081I07 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR462584 RBdS156H16 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
HKR475079 RBdS187L15 pGCAP10 NM_002165.2  
GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl