Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081I07

Clone ID RBdS081I07
HP ID HP00466
Gene ID 3397
Gene Symbol ID1
Protein Name inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002165.2
Length of RefSeq (bp) 993
Chromosome 20q11
Reference DDBJ accession
UniGene Hs.504609
5'-terminal sequence GATTCCACGTTCTTAACTGTTCCATTTTCCGTATCTGCTTCGGGCTTCCACCTCATTTTT
2011.08.28