Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HSPD1

Gene ID (NCBI) 3329
Gene Symbol HSPD1
Protein Name heat shock 60kDa protein 1 (chaperonin)
Synonyms CPN60|GROEL|HLD4|HSP-60|HSP60|HSP65|HuCHA60|SPG13
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04077)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03870 SEREX clone NGO-St-116 (ID 1327) #1 SEREX clone NGO-St-116 (ID 1327) #1
RDB03876 SEREX clone NGO-St-116 (ID 1327) #2 SEREX clone NGO-St-116 (ID 1327) #2

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083727 IRAL009F07 pOTB7 BC003030 NM_199440 Full
HGY085053 IRAL012K13 pOTB7 BC002676 NM_199440 Full
HGY100053 IRAL050C05 pOTB7 BC067082 NM_199440 Full
HGY103492 IRAL058M04 pOTB7 BC073746 NM_199440 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015646 W01A039B22 pENTR-TOPO IRAL012K13 BC002676 NM_199440  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161751 ARi04G07 pGCAP10 NM_002156.4  
CGGCCGGCCGATGCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCC
HKR165749 ARi14G05 pGCAP10 NM_002156.4  
AGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATAC
HKR056429 ARe41B05 pKA1U5 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAG
HKR179773 ARi49H05 pGCAP10 NM_002156.4  
GATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGA
HKR062456 ARe56C08 pKA1U5 NM_002156.4  
ATCCTGGCCCTCACTCGCCGCCGACGACCTGATCCCGNTCNAGCGCACGCCTTGCCGCCG
HKR063229 ARe58B05 pKA1U5 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAG
HKR186008 ARi65A08 pGCAP10 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAA
HKR070928 ARe77F08 pKA1U5 NM_002156.4  
GACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGNCTTGCCGCCGCCCCGCAGAAATG
HKR071605 ARe79A05 pKA1U5 NM_002156.4  
ATCCTGGCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCC
HKR076436 ARe91B12 pKA1U5 NM_002156.4  
ANCCNGGNTACNTNANTTTTTCTTTCTTACTTACTTTTTTTTTTTTATTTTTTTTTTTTC
HKR203357 ARiS008G13 pGCAP10 NM_002156.4  
GCCCTCACTCGCCNCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAG
HKR248918 ARiS122E22 pGCAP10 NM_002156.4  
GCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAGAA
HKR248927 ARiS122F07 pGCAP10 NM_002156.4  
GGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGC
HKR323659 RBb09C11 pKA1U5 NM_002156.4  
GACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAGAAATG
HKR361252 RBd03C04 pGCAP10 NM_002156.4  
GGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCC
HKR328052 RBb20C04 pKA1U5 NM_002156.4  
ATCCTGGCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCC
HKR330908 RBb27E12 pGCAP1 NM_002156.4  
GGTAGAGGCGGAGGGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCT
HKR370501 RBd26E05 pGCAP10 NM_002156.4  
CTTTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGA
HKR375753 RBd39G09 pGCAP10 NM_002156.4  
GACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGT
HKR336029 RBb40B05 pGCAP1 NM_002156.4  
TTGGACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAGAA
HKR378532 RBd46F12 pGCAP10 NM_002156.4  
GAGAGGCGGAGGGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCA
HKR382955 RBd57G11 pGCAP10 NM_002156.4  
GGGGAGTAGAGGCGGAGGGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGT
HKR344547 RBb61G03 pGCAP1 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAG
HKR344575 RBb61H07 pGCAP1 NM_002156.4  
HKR386432 RBd66B08 pGCAP10 NM_002156.4  
GACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAGAAATG
HKR405941 RBdS014O05 pGCAP10 NM_002156.4  
GACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAGAAATG
HKR409064 RBdS022K24 pGCAP10 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAG
HKR428016 RBdS070A16 pGCAP10 NM_002156.4  
GCTTTCAGCGCCTGCAGGTTCCGGGAGCTCCCAGCCGAGGACGTCGGATGTCATCGTCCT
HKR428017 RBdS070A17 pGCAP10 NM_002156.4  
GGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCG
HKR442108 RBdS105E12 pGCAP10 NM_002156.4  
GCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAG
HKR461644 RBdS154B20 pGCAP10 NM_002156.4  
GCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCTGCCGCCCCGCAGA
HKR462762 RBdS156P02 pGCAP10 NM_002156.4  
GAGAGGCGGAGGGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl