Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156P02

Clone ID RBdS156P02
HP ID HP00890
Gene ID 3329
Gene Symbol HSPD1
Protein Name heat shock 60kDa protein 1 (chaperonin)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002156.4
Length of RefSeq (bp) 2339
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.719142
5'-terminal sequence GAGAGGCGGAGGGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCA
2011.08.28