Prev. |  KEGG KO K04455 > 

RIKEN DNA Bank Human Resource - HSPB1

Gene ID NCBI Gene 3315 |  KEGG hsa:3315
Gene Symbol HSPB1
Protein Name heat shock protein family B (small) member 1
Synonyms CMT2F|HEL-S-102|HMN2B|HS.76067|HSP27|HSP28|Hsp25|SRP27
Ortholog resource in our bank

  HSPB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03172 heat shock protein 27/pBluescript (HSP27/pBS) Plasmid clone of human heat shock protein 27 cDNA
RDB07530 pGL4-phHSPB1 Promoter collection, Human HSPB1 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006020 IRAK015A20 pCMV-SPORT6 BC014920 NM_001540 Partial
HGX008592 IRAK021H24 pCMV-SPORT6 BC012292 NM_001540 Full/var
HGY080588 IRAL001H20 pOTB7 BC000510 NM_001540 Full
HGY089764 IRAL024G20 pOTB7 BC012768 NM_001540 Full
HGY103345 IRAL058G01 pOTB7 BC073768 NM_001540 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040376 W01A100P16 pENTR-TOPO IRAL001H20 BC000510 NM_001540  
HGE040737 W01A101O01 pENTR-TOPO IRAL001H20 BC000510 NM_001540  
HGE040741 W01A101O05 pENTR-TOPO IRAL001H20 BC000510 NM_001540  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042905 ARe07E09 pKA1U5 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR044570 ARe11H02 pKA1U5 NM_001540.3  
GCCCCCAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTC
HKR046081 ARe15D09 pKA1U5 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR046150 ARe15G06 pKA1U5 NM_001540.3  
GAGTCTGATTTCCCTCTTCCCCCCAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATGGC
HKR052855 ARe32C07 pKA1U5 NM_001540.3  
ATCCTGTACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGC
HKR054507 ARe36E11 pKA1U5 NM_001540.3  
ACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCCT
HKR060552 ARe51G08 pKA1U5 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR064482 ARe61D10 pKA1U5 NM_001540.3  
GAGTCCTGGCTGCTTCCAAGCAGGAGGTGGGGCCTCTGGCCTAGCGGGGCCGAAAGGCAG
HKR069704 ARe74E08 pKA1U5 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR070099 ARe75E03 pKA1U5 NM_001540.3  
ACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCATTATGACCGAGCGCCGCGTCCCCT
HKR075776 ARe89H08 pKA1U5 NM_001540.3  
GACCCGACTGGAGGAGCATAAAAGCGCAGCCGAGCCCAGCGCCCCGCACTTTTCTGAGCA
HKR078932 ARe97F12 pKA1U5 NM_001540.3  
TAAAACACCGCCTGCTAAAAATACCCGACTGGAGGAGCATAAAAGCGCAGCCGAGCCCAG
HKR082176 ARf05H08 pKA1U5 NM_001540.3  
TGACTTTTCTGAGNAGACGATCCAGAGCAGAGTNAGCCANCATGACCGAGCGNCNCGTCC
HKR163279 ARi08D07 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR172407 ARi31A07 pGCAP10 NM_001540.3  
GGCCATTAATAGAGACCTCAAACACCGCCTGCTAAAAATACCCGACTGGAGGAGCATAAA
HKR203258 ARiS008C10 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR203478 ARiS008L14 pGCAP10 NM_001540.3  
GACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCC
HKR208057 ARiS020C09 pGCAP10 NM_001540.3  
GGCAGCCGAGCCCAGCGCCCCGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAG
HKR209236 ARiS023B12 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR234955 ARiS087G11 pGCAP10 NM_001540.3  
GACTTTTCTGANCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCC
HKR243746 ARiS109G02 pGCAP10 NM_001540.3  
GACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCC
HKR264767 ARiS161P07 pGCAP10 NM_001540.3  
GATTGCCATTAATAGAGACCTCAAACACCGCCTGCTAAAAATACCCGACTGGAGGAGCAT
HKR321700 RBb04E04 pKA1U5 NM_001540.3  
GCCCCCCAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTT
HKR331376 RBb28H08 pGCAP1 NM_001540.3  
GCCCCCCAAAGGCAAGCACGTAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCT
HKR331605 RBb29A05 pGCAP1 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR332801 RBb32A01 pGCAP1 NM_001540.3  
GGCAGTCTGATTTCCCTCTTCCCCCCAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATG
HKR333729 RBb34F09 pGCAP1 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR335301 RBb38E05 pGCAP1 NM_001540.3  
ACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCCT
HKR340898 RBb52E02 pGCAP1 NM_001540.3  
CTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCCTT
HKR347380 RBb68H12 pGCAP1 NM_001540.3  
AAATGTGGCCCCCAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCG
HKR387611 RBd69A11 pGCAP10 NM_001540.3  
GAAAGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCG
HKR396974 RBd92H06 pGCAP10 NM_001540.3  
GGGCCCTCAAACGGGTCATTGCCATTAATAGAGACCTCAAACACCGCCTGCTAAAAATAC
HKR398501 RBd96E05 pGCAP10 NM_001540.3  
GACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCCCC
HKR402946 RBdS007G02 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR409174 RBdS022P14 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR428300 RBdS070M12 pGCAP10 NM_001540.3  
GGCACTTTTCTGAGCAGACGTCCAGAGCAGAGTCAGCCAGCATGACCGAGCGCCGCGTCC
HKR461724 RBdS154F04 pGCAP10 NM_001540.3  
GGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl