Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154F04

Clone ID RBdS154F04
HP ID HP00954
Gene ID 3315
Gene Symbol HSPB1
Protein Name heat shock 27kDa protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001540.3
Length of RefSeq (bp) 914
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.520973
5'-terminal sequence GGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGC
2011.08.28