Prev. |  KEGG KO K04043 > 

RIKEN DNA Bank Human Resource - HSPA9

Gene ID NCBI Gene 3313 |  KEGG hsa:3313
Gene Symbol HSPA9
Protein Name heat shock protein family A (Hsp70) member 9
Synonyms CRP40|CSA|EVPLS|GRP-75|GRP75|HEL-S-124m|HSPA9B|MOT|MOT2|MTHSP75|PBP74|SAAN|SIDBA4
Ortholog resources KEGG ortholog (KEGG orthology K04043) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080763 IRAL001P03 pOTB7 BC000478 NM_004134 Full/var
HGY084381 IRAL010P21 pOTB7 BC024034 NM_004134 Full/var
HGY090133 IRAL025F13 pOTB7 BC030634 NM_004134 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219733 ARiS049F13 pGCAP10 NM_004134.5  
GAGAAGCGCTGCCGCCACCGCATCGCGCAGCTCTTTGCCGTCGGAGCGCTTGTTTGCTGC
HKR234828 ARiS087B04 pGCAP10 NM_004134.5  
GGCCCACGTGGTTGGAGGTTTCCAGAAGCGCTGCCGCCACCGCATCGCGCAGCTCTTTGC
HKR322430 RBb06B06 pKA1U5 NM_004134.5  
GACCCCACGTGGTTGGAGGTTTCCAGAAGCGCTGCCGCCACCGCATCGCGCAGCTCTTTG
HKR361259 RBd03C11 pGCAP10 NM_004134.5  
GGCCCCTCACCCCACGTGGTTGGATGTTTCCAGAAACTCTGCCNCCCCCGCATCNANCTT
HKR397746 RBd94G02 pGCAP10 NM_004134.5  
GGTGGTTGGAGGTTTCCAGAAGCGCTGCCGCCACCGCATCGCGCAGCTCTTTGCCGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl