ARiS049F13 NRCD Human cDNA Clone

Prev. | Human A to Z list > H > HSPA9 >

ARiS049F13 - NRCD Human cDNA Clone


Catalog Number	HKR219733
Clone Name	ARiS049F13
Clone info.	Plasmid clone of human HSPA9 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GAGAAGCGCTGCCGCCACCGCATCGCGCAGCTCTTTGCCGTCGGAGCGCTTGTTTGCTGC
Sequence, submitted⁽³⁾	n.a.
Sequence, refered	NM_004134.5 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	HSPA9 (NCBI Gene 3313) other clone of HSPA9 in our bank
Synonyms	CRP40\|CSA\|EVPLS\|GRP-75\|GRP75\|HEL-S-124m\|HSPA9B\|MOT\|MOT2\|MTHSP75\|PBP74\|SAAN\|SIDBA4
Protein Name	heat shock protein family A (Hsp70) member 9

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR219733	ARiS049F13	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARiS049F13 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR219733).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.