Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HSPA8

Gene ID (NCBI) 3312
Gene Symbol HSPA8
Protein Name heat shock 70kDa protein 8
Synonyms HEL-33|HEL-S-72p|HSC54|HSC70|HSC71|HSP71|HSP73|HSPA10|LAP1|NIP71
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006019 IRAK015A19 pCMV-SPORT6 BC015699 NM_006597 Partial
HGX006302 IRAK015M14 pCMV-SPORT6 BC016179 NM_006597 Full
HGX010502 IRAK026E06 pCMV-SPORT6 BC016660 NM_006597 Full
HGX016801 IRAK042A01 pCMV-SPORT6 BC019816 NM_006597 Full
HGY089016 IRAL022I24 pOTB7 BC007276 NM_153201 Partial/var
HGY089882 IRAL024L18 pOTB7 BC008907 NM_006597 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082010 M01C005A10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  
HGE082058 M01C005C10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  
HGE082106 M01C005E10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  
HGE082154 M01C005G10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  
HGE082202 M01C005I10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  
HGE082250 M01C005K10 pDONR221 04-134-2_3-B05 AK129885 NM_153201  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040812 ARe02A12 pKA1U5 NM_006597.3  
AACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCAGGCCTACA
HKR043754 ARe09G10 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR160454 ARi01C06 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR160456 ARi01C08 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR045303 ARe13E07 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR046405 ARe16A05 pKA1U5 NM_006597.3  
TTTGGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTG
HKR048578 ARe21H10 pKA1U5 NM_006597.3  
GGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR170127 ARi25F07 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR172475 ARi31D03 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR172945 ARi32G01 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR175256 ARi38C08 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR058857 ARe47C09 pKA1U5 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR180506 ARi51E10 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR183274 ARi58D02 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR070452 ARe76C04 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTCCCTTTNNCTTCCTTCGTTATTGGAGCCA
HKR188431 ARi71B07 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR076458 ARe91C10 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR078080 ARe95D08 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR209566 ARiS023P06 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR219702 ARiS049E06 pGCAP10 NM_006597.3  
TAGCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR219848 ARiS049K08 pGCAP10 NM_006597.3  
CTCTCTCATTGAACTCGCCTGCANCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR234941 ARiS087F21 pGCAP10 NM_006597.3  
HKR243957 ARiS109O21 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR264524 ARiS161F04 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR279407 ARiS198I15 pGCAP10 NM_006597.3  
HKR279475 ARiS198L11 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR320527 RBb01F07 pKA1U5 NM_006597.3  
GCTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR326860 RBb17C12 pKA1U5 NM_006597.3  
GCTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR326954 RBb17G10 pKA1U5 NM_006597.3  
HKR327611 RBb19A11 pKA1U5 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR364810 RBd12A10 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR366405 RBd16A05 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR368881 RBd22D09 pGCAP10 NM_006597.3  
GCTCATTGANTCGCCTGCAGCTCTTGNTTTTTTGTGNNNCNTTCGTTATNGAGCNGNCTA
HKR371260 RBd28C12 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR335682 RBb39D10 pGCAP1 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR373653 RBd34C05 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR373729 RBd34F09 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR336901 RBb42E05 pGCAP1 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR339747 RBb49G03 pGCAP1 NM_006597.3  
GTGGCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR376006 RBd40A06 pGCAP10 NM_006597.3  
GCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCAGG
HKR379634 RBd49B10 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR340408 RBb51A08 pGCAP1 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR341323 RBb53F03 pGCAP1 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR342145 RBb55G01 pGCAP1 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR342831 RBb57B07 pGCAP1 NM_006597.3  
GGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGATTATTGGAG
HKR343208 RBb58A08 pGCAP1 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGNTTATTGGAGCC
HKR343702 RBb59E06 pGCAP1 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR380005 RBd50A05 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR344578 RBb61H10 pGCAP1 NM_006597.3  
ATGCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR384404 RBd61A04 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR386577 RBd66H09 pGCAP10 NM_006597.3  
GGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR394036 RBd85B12 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR395354 RBd88G10 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR396132 RBd90F12 pGCAP10 NM_006597.3  
TGGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGA
HKR405833 RBdS014J17 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR408948 RBdS022G04 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR416193 RBdS040I01 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR441640 RBdS104B16 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR444106 RBdS110E10 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG
HKR452912 RBdS132E16 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR452991 RBdS132H23 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR461860 RBdS154K20 pGCAP10 NM_006597.3  
GGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGC
HKR462709 RBdS156M21 pGCAP10 NM_006597.3  
TGCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCC
HKR462716 RBdS156N04 pGCAP10 NM_006597.3  
GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
HKR474968 RBdS187G24 pGCAP10 NM_006597.3  
GGGTCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl