Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014J17

Clone ID RBdS014J17
HP ID HP00070
Gene ID 3312
Gene Symbol HSPA8
Protein Name heat shock 70kDa protein 8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006597.3
Length of RefSeq (bp) 2276
Chromosome 11q24.1
Reference DDBJ accession
UniGene Hs.702021
5'-terminal sequence GCTCATTGAACTCGCCTGCAGCTCTTGGGTTTTTTGTGGCTTCCTTCGTTATTGGAGCCA
2011.08.28