Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HSPA1B

Gene ID (NCBI) 3304
Gene Symbol HSPA1B
Protein Name heat shock 70kDa protein 1B
Synonyms HSP70-1B|HSP70-2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX044326 IRAK110N14 pCMV-SPORT6 BC057397 NM_005346 Full/var
HGX053619 IRAK134A19 pCMV-SPORT6 BC063507 NM_005346 Full/var
HGY083292 IRAL008D20 pOTB7 BC001876 NM_005346 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462450 RBdS156C02 pGCAP10 NM_005346.4  
GGGAAAACGGCCAGCCTGAGGAGCTGCTGCGAGGGTCCGCTTCGTCTTTCGAGAGTGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl