Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156C02

Clone ID RBdS156C02
HP ID HP09232
Gene ID 3304
Gene Symbol HSPA1B
Protein Name heat shock 70kDa protein 1B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005346.4
Length of RefSeq (bp) 2551
Chromosome 6p21.3
Reference DDBJ accession
UniGene
5'-terminal sequence GGGAAAACGGCCAGCCTGAGGAGCTGCTGCGAGGGTCCGCTTCGTCTTTCGAGAGTGACT
2011.08.28