Prev. |  KEGG KO K02833 > 

RIKEN DNA Bank Human Resource - HRAS

Gene ID NCBI Gene 3265 |  KEGG hsa:3265
Gene Symbol HRAS
Protein Name HRas proto-oncogene, GTPase
Synonyms C-BAS/HAS|C-H-RAS|C-HA-RAS1|CTLO|H-RASIDX|HAMSV|HRAS1|KRAS|KRAS2|Ki-Ras|RASH1|RASK2|c-K-ras|c-Ki-ras|p21ras
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Endocytosis (human)
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content Mitophagy - human
Ortholog resource in our bank

  HRAS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080953 IRAL002G09 pOTB7 BC006499 NM_176795 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013513 W01A033N01 pENTR-TOPO IRAL002G09 BC006499 NM_176795.5 full done
HGE013515 W01A033N03 pENTR-TOPO IRAL002G09 BC006499 NM_176795  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187230 ARi68B06 pGCAP10 NM_005343.2  
GACTTCGCCGGGCGGGCCCTGCGCCCGCAACCCGAGCCGCCCCCGCCGCGGACGGAACCC
HKR276757 ARiS191O21 pGCAP10 NM_005343.2  
GACCCGAGCCGCACCCGCCGCGGACGGAGCCCATGCGCGGGGCGAACCGCGCGCCCCCGC
HKR430074 RBdS075D02 pGCAP10 NM_005343.2  
GGCAACCCGAGCCGCACCCGCCGCGGACGGAGCCCATGCGCGGGGCGAACCGCGCGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl