Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075D02

Clone ID RBdS075D02
HP ID HP03254
Gene ID 3265
Gene Symbol HRAS
Protein Name v-Ha-ras Harvey rat sarcoma viral oncogene homolog
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005343.2
Length of RefSeq (bp) 2061
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.37003
5'-terminal sequence GGCAACCCGAGCCGCACCCGCCGCGGACGGAGCCCATGCGCGGGGCGAACCGCGCGCCCC
2011.08.28