Prev. | 

RIKEN DNA Bank Human Resource - HPCA

Gene ID NCBI Gene 3208 |  KEGG hsa:3208
Gene Symbol HPCA
Protein Name hippocalcin
Synonyms BDR2|DYT2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082777 IRAL006P17 pOTB7 BC001777 NM_002143

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004412 W01A011A12 pENTR-TOPO IRAL006P17 BC001777 NM_002143  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322170 RBb05H02 pKA1U5 NM_002143.2  
GCTGCCGCCCCTGCCGCGCGCGCCGCAGCAGCGCCGCCTTCCCTGCGCAGTCGGTGTCTC
HKR325325 RBb13F05 pKA1U5 NM_002143.2  
HKR335707 RBb39E11 pGCAP1 NM_002143.2  
GCCCCTCCTGCCGCCCCTGCCGCGCGCGCCGCAGCAGCGCCGCCTTCCCTGCGCAGTCGG
HKR368980 RBd22H12 pGCAP10 NM_002143.2  
GGGGTCGGGGTGAGGTCTGGAGTGGTGGGTTT
HKR388145 RBd70G01 pGCAP10 NM_002143.2  
GGGTGTCTCCGCGTCGCTGGAACTGGCTGGCTGTTTCCTCTTCATTGCCTTCTACTCAGC
HKR405630 RBdS014B06 pGCAP10 NM_002143.2  
GCTGCCGCCCCTGCCGCGCGCGCCGCAGCAGCGCCGCCTTCCCTGCGCAGTCGGTGTCTC
HKR420747 RBdS051O11 pGCAP10 NM_002143.2  
GGGTGTCTCCGCGTCGCTGGGTGGGACTTGGCTCGGCGGCCATGGGCAAGCAGAACAGCA
HKR428213 RBdS070I21 pGCAP10 NM_002143.2  
CCTTCCCTGCGCAGTCGGTGTCTCCGCGTCGCTGGGCCATTTACAAGATGGTTTCGTCCG
HKR432579 RBdS081H11 pGCAP10 NM_002143.2  
GGGACAGGCTGTGGGAGAAGGTGATGGGGTGACCATTGGCAGGCTTACGTCAGGGTGTCT
HKR433471 RBdS083L07 pGCAP10 NM_002143.2  
GGCCTTCCCTGCGCAGTCGGTGTCTCCGCGTCGCTGGGCCATTTACAAGATGGTTTCGTC
HKR444192 RBdS110H24 pGCAP10 NM_002143.2  
GGCAGTCGGTGTCTCCGCGTCGCTGGGTGGGACTTGGCTCGGCGGCCATGGGCAAGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl