Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110H24

Clone ID RBdS110H24
HP ID HP05231
Gene ID 3208
Gene Symbol HPCA
Protein Name hippocalcin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002143.2
Length of RefSeq (bp) 1440
Chromosome 1p35.1
Reference DDBJ accession
UniGene Hs.632391
5'-terminal sequence GGCAGTCGGTGTCTCCGCGTCGCTGGGTGGGACTTGGCTCGGCGGCCATGGGCAAGCAGA
2011.08.28