Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HMGB1

Gene ID (NCBI) 3146
Gene Symbol HMGB1
Protein Name high mobility group box 1
Synonyms HMG1|HMG3|SBP-1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10802)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY066874 IRAK167D02 pBluescriptR BC067732 NM_002128 Full
HGX001417 IRAK003J01 pCMV-SPORT6 BC003378 NM_002128 Full
HGY067110 IRAK167M22 pBluescriptR BC066889 NM_002128 Full
HGY096413 IRAL041A13 pDNR-LIB BC030981 NM_002128 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000542 W01A001F22 pENTR-TOPO IRAK167M22 BC066889 NM_002128  
HGE000544 W01A001F24 pENTR-TOPO IRAK167M22 BC066889 NM_002128  
HGE000570 W01A001H02 pENTR-TOPO IRAK003J01 BC003378 NM_002128  
HGE000576 W01A001H08 pENTR-TOPO IRAK003J01 BC003378 NM_002128  
HGE000582 W01A001H14 pENTR-TOPO IRAL041A13 BC030981 NM_002128  
HGE000584 W01A001H16 pENTR-TOPO IRAL041A13 BC030981 NM_002128  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080475 ARf01D03 pKA1U5 NM_002128.4  
GGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGAC
HKR164084 ARi10D12 pGCAP10 NM_002128.4  
GGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCC
HKR174884 ARi37D12 pGCAP10 NM_002128.4  
GGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGA
HKR179630 ARi49B06 pGCAP10 NM_002128.4  
GATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCA
HKR061370 ARe53H02 pKA1U5 NM_002128.4  
GGCAGTTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACT
HKR066036 ARe65B12 pKA1U5 NM_002128.4  
GGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGA
HKR218249 ARiS045K09 pGCAP10 NM_002128.4  
TGGGTCTGGCTCCCGCTCTCACANCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCC
HKR260111 ARiS150E15 pGCAP10 NM_002128.4  
GATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCG
HKR324874 RBb12D02 pKA1U5 NM_002128.4  
GCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCG
HKR326079 RBb15D07 pKA1U5 NM_002128.4  
ATCCTGTGGAGAGTAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGC
HKR364801 RBd12A01 pGCAP10 NM_002128.4  
GACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTA
HKR364924 RBd12F04 pGCAP10 NM_002128.4  
GAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACG
HKR367703 RBd19E07 pGCAP10 NM_002128.4  
GGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCA
HKR330034 RBb25B10 pGCAP1 NM_002128.4  
GCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCG
HKR330951 RBb27G07 pGCAP1 NM_002128.4  
GACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGTAGAGCCGG
HKR369300 RBd23E04 pGCAP10 NM_002128.4  
GAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGG
HKR371675 RBd29D03 pGCAP10 NM_002128.4  
GATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCG
HKR371754 RBd29G10 pGCAP10 NM_002128.4  
GATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCA
HKR375673 RBd39D01 pGCAP10 NM_002128.4  
TGTGCGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCG
HKR376531 RBd41F11 pGCAP10 NM_002128.4  
GACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGA
HKR376555 RBd41G11 pGCAP10 NM_002128.4  
GAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGG
HKR378569 RBd46H01 pGCAP10 NM_002128.4  
ATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACGGAGTTTTGCTCTTGTCNCCCA
HKR343654 RBb59C06 pGCAP1 NM_002128.4  
GAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACG
HKR382554 RBd56G10 pGCAP10 NM_002128.4  
GGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGA
HKR382877 RBd57D05 pGCAP10 NM_002128.4  
GAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGNCGGACGGGCACTGGG
HKR346073 RBb65D01 pGCAP1 NM_002128.4  
AGGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACG
HKR392881 RBd82D09 pGCAP10 NM_002128.4  
GATTTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGC
HKR393250 RBd83C02 pGCAP10 NM_002128.4  
GGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCATTGCA
HKR395301 RBd88E05 pGCAP10 NM_002128.4  
GAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACG
HKR395328 RBd88F08 pGCAP10 NM_002128.4  
GAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCGCT
HKR403053 RBdS007K13 pGCAP10 NM_002128.4  
GGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTG
HKR406022 RBdS015A22 pGCAP10 NM_002128.4  
TGGAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCA
HKR406118 RBdS015E22 pGCAP10 NM_002128.4  
TGGAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCA
HKR416226 RBdS040J10 pGCAP10 NM_002128.4  
GGTCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGG
HKR444127 RBdS110F07 pGCAP10 NM_002128.4  
GTAATGTTACAGAGCGGAGAGAGTGAGGAGGCTGCGTCTGGCTCCCGCTCTCACAGCCAT
HKR462593 RBdS156I01 pGCAP10 NM_002128.4  
GAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCGCT
HKR471146 RBdS177O10 pGCAP10 NM_002128.4  
TGCTGGCTCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl