Prev. |  Human A to Z list >  H >  HMGB1 > 

RBd12F04 - NRCD Human cDNA Clone

Catalog Number HKR364924
Clone Name RBd12F04
Clone info. Plasmid clone of human HMGB1 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GAGCCATTGCAGTACATTGAGCTCCATAGAGACAGCGCCGGGGCAAGTGAGAGCCGGACG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_002128.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) HMGB1 (NCBI Gene 3146)  other clone of HMGB1 in our bank
Synonyms HMG-1|HMG1|HMG3|SBP-1
Protein Name high mobility group box 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR364924 RBd12F04 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd12F04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR364924).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl