Prev. |  KEGG KO K03141 > 

RIKEN DNA Bank Human Resource - GTF2H1

Gene ID NCBI Gene 2965 |  KEGG hsa:2965
Gene Symbol GTF2H1
Protein Name general transcription factor IIH subunit 1
Synonyms BTF2|P62|TFB1|TFIIH
Featured content DNA repair (human)
Ortholog resource in our bank

  GTF2H1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080402 IRAL001A02 pOTB7 BC000365 NM_005316 Full
HGY083795 IRAL009I03 pOTB7 BC004452 NM_005316

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002744 W01A006O08 pENTR-TOPO IRAL001A02 BC000365 NM_005316  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187612 ARi69A12 pGCAP10 NM_005316.3  
GGCAGCCAGCGATGGAGGCGAGACCCCCTAGTAACAGAGGCGGTGGCTACTGCTGCGGCC
HKR360978 RBd02H10 pGCAP10 NM_005316.3  
GCTCCTCGCAGCCAGCGATGGAGGCGAGACCCCCTAGTAACAGAGGCGGTGGCTACTGCT
HKR430350 RBdS075O14 pGCAP10 NM_005316.3  
GAGACTCCTCGCAGCCAGCGATGGAGGCGAGACCCCCTAGTAACAGAGGCGGTGGCTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl