Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075O14

Clone ID RBdS075O14
HP ID HP03808
Gene ID 2965
Gene Symbol GTF2H1
Protein Name general transcription factor IIH, polypeptide 1, 62kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005316.3
Length of RefSeq (bp) 3308
Chromosome 11p15.1-p14
Reference DDBJ accession
UniGene Hs.577202
5'-terminal sequence GAGACTCCTCGCAGCCAGCGATGGAGGCGAGACCCCCTAGTAACAGAGGCGGTGGCTACT
2011.08.28