Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - GSTP1

Gene ID NCBI Gene 2950 |  KEGG hsa:2950
Gene Symbol GSTP1
Protein Name glutathione S-transferase pi 1
Synonyms DFN7|FAEES3|GST3|GSTP|HEL-S-22|PI
Ortholog resources KEGG ortholog (KEGG orthology K00799) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01393 pGPi2 Human glutathione transferase - pi cDNA
RDB02288 pAxCAhGST pi (reverse) Shuttle vector to produce rAd expressing human GST pi
RDB02289 pAxCAhGST pi (forward) Shuttle vector to produce rAd expressing human GST pi
RDB02740 AxCAhGST pi (forward) Recombinant adenovirus harboring human glutathione S-transferase pi cDNA
RDB07477 pGL4-phGSTP1 Promoter collection, Human GSTP1 promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087615 IRAL019A15 pDNR-LIB BC010915 NM_000852 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096429 M01C041B05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096477 M01C041D05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096525 M01C041F05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096573 M01C041H05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096621 M01C041J05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096669 M01C041L05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096717 M01C041N05 pDONR221 MGC10-C03 BC010915 NM_000852  
HGE096765 M01C041P05 pDONR221 MGC10-C03 BC010915 NM_000852  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040829 ARe02B05 pKA1U5 NM_000852.3  
TGGGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTAT
HKR041728 ARe04F08 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR042122 ARe05F02 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCATACACCGNTGGTCTATTTCC
HKR044432 ARe11B08 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGTCCGCCCATACACCGGTGGTCTATTTC
HKR044854 ARe12C06 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR049707 ARe24E11 pKA1U5 NM_000852.3  
TGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCTTCCTACACCGNTGGTCTATTTCC
HKR050579 ARe26H11 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGNCGCCCTACACCGNTGGTCTATTT
HKR050969 ARe27H01 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR052006 ARe30A06 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR052435 ARe31B11 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR052548 ARe31G04 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR053697 ARe34E01 pKA1U5 NM_000852.3  
ACGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCC
HKR056080 ARe40D08 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGCTCTTCGCCACCCNGNTNGCCCTACACCGNTGGTCTAT
HKR056433 ARe41B09 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR056932 ARe42F12 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR057209 ARe43A09 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR060003 ARe50A03 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGNTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCC
HKR061612 ARe54A12 pKA1U5 NM_000852.3  
TTGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCC
HKR062573 ARe56H05 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCCNTTNATACACCGGTGGTCTATTTC
HKR062875 ARe57D03 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR063753 ARe59G09 pKA1U5 NM_000852.3  
TCGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTT
HKR064974 ARe62H06 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR067280 ARe68D08 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCTCCCTACACCGNTGGTCTATTTCCC
HKR067281 ARe68D09 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR068033 ARe70B09 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR070836 ARe77B12 pKA1U5 NM_000852.3  
ATCCTGGGGAGTTTCGCCGCCGCAGTCTTCGCCACNNTGCCGCCCTACACCGTGGTCTAT
HKR071328 ARe78F08 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTT
HKR072031 ARe80B07 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR074826 ARe87B02 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR075276 ARe88D04 pKA1U5 NM_000852.3  
GGCTGGAGTTTCNCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGNTCTATT
HKR078028 ARe95B04 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR078457 ARe96C09 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR082478 ARf06D06 pKA1U5 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCAATGTCCGCCCTACACCGNTGGTCTATTTC
HKR161704 ARi04E08 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR162058 ARi05C10 pGCAP10 NM_000852.3  
CGGCCGGCCGATGGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACC
HKR162082 ARi05D10 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR163257 ARi08C09 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR163682 ARi09D10 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR163697 ARi09E01 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR165627 ARi14B03 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR168102 ARi20E06 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR175205 ARi38A05 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR179204 ARi48A04 pGCAP10 NM_000852.3  
CGGCCGGCCGATGGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACC
HKR179603 ARi49A03 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR179724 ARi49F04 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR181249 ARi53C01 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR182074 ARi55D02 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR184407 ARi61A07 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR186155 ARi65G11 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR205391 ARiS013H23 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR205570 ARiS013P10 pGCAP10 NM_000852.3  
GGCTGGNNTTTCNCCNCCGCANTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR208384 ARiS020P24 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR218274 ARiS045L10 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR222187 ARiS055H19 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR222195 ARiS055I03 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCACTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR234830 ARiS087B06 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR234888 ARiS087D16 pGCAP10 NM_000852.3  
GGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGGCCGCTG
HKR235357 ARiS088G13 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR243801 ARiS109I09 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR247447 ARiS118K07 pGCAP10 NM_000852.3  
GGGAGTTTCNCCGCCGCANTCTTCNCCACCNTGCCGCCCTACACCGTGGTCTATTTCCCA
HKR320927 RBb02F07 pKA1U5 NM_000852.3  
TGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCC
HKR321233 RBb03B09 pKA1U5 NM_000852.3  
HKR322507 RBb06E11 pKA1U5 NM_000852.3  
TGGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCCAG
HKR323626 RBb09B02 pKA1U5 NM_000852.3  
GAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGGCCGCTGCG
HKR326804 RBb17A04 pKA1U5 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR327376 RBb18H08 pKA1U5 NM_000852.3  
TGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCC
HKR335233 RBb38B09 pGCAP1 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTCCC
HKR337721 RBb44F01 pGCAP1 NM_000852.3  
TTGGAGGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTC
HKR337778 RBb44H10 pGCAP1 NM_000852.3  
TTGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGNTGGTCTATTTC
HKR340500 RBb51E04 pGCAP1 NM_000852.3  
TGTTGGCTGGAGNTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTTGGTC
HKR344107 RBb60E11 pGCAP1 NM_000852.3  
GGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGG
HKR344426 RBb61B02 pGCAP1 NM_000852.3  
TGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCC
HKR345308 RBb63E12 pGCAP1 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR348150 RBb70G06 pGCAP1 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR348432 RBb71B08 pGCAP1 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR348523 RBb71F03 pGCAP1 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR362806 RBd07A06 pGCAP10 NM_000852.3  
TGGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCC
HKR362807 RBd07A07 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR364435 RBd11B11 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR364906 RBd12E10 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR367705 RBd19E09 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR367770 RBd19H02 pGCAP10 NM_000852.3  
TGGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTT
HKR373210 RBd33A10 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR373249 RBd33C01 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR374174 RBd35H06 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR374555 RBd36G11 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR376898 RBd42E02 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR378049 RBd45C01 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR378404 RBd46A04 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR384881 RBd62D09 pGCAP10 NM_000852.3  
GGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGG
HKR385769 RBd64H01 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR386151 RBd65G07 pGCAP10 NM_000852.3  
GGCTGGNNTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR386504 RBd66E08 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR390575 RBd76H07 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR390974 RBd77H06 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR391780 RBd79H12 pGCAP10 NM_000852.3  
GAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGT
HKR393707 RBd84E11 pGCAP10 NM_000852.3  
GACCCTTATAAGGCTCGGAGGCCGCGAGGCCTTCGCTGGAGTTTCGCCGCCGCAGTCTTC
HKR393756 RBd84G12 pGCAP10 NM_000852.3  
GNTTGGAGTTTCCCCGCCGCTTTCTTCGCCACCATGNCNCCCTACNNNNTGGTCTATTTC
HKR395277 RBd88D05 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR396177 RBd90H09 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR398001 RBd95A01 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR399652 RBd99C04 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR405484 RBdS013L20 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR405640 RBdS014B16 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR405660 RBdS014C12 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR405722 RBdS014F02 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR406109 RBdS015E13 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR416079 RBdS040D07 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR416277 RBdS040L13 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR420750 RBdS051O14 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR430376 RBdS075P16 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR432505 RBdS081E09 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR432546 RBdS081G02 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR441726 RBdS104F06 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR442178 RBdS105H10 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR442322 RBdS105N10 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR461971 RBdS154P11 pGCAP10 NM_000852.3  
GTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCC
HKR462488 RBdS156D16 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
HKR462663 RBdS156K23 pGCAP10 NM_000852.3  
GATAAGGCTCGGAGGCCGCGAGGCCTTCGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACC
HKR475058 RBdS187K18 pGCAP10 NM_000852.3  
GGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTC
HKR475132 RBdS187N20 pGCAP10 NM_000852.3  
GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl