Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015E13

Clone ID RBdS015E13
HP ID HP00473
Gene ID 2950
Gene Symbol GSTP1
Protein Name glutathione S-transferase pi
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000852.3
Length of RefSeq (bp) 986
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.523836
5'-terminal sequence GGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCA
2011.08.28