Prev. | 

RIKEN DNA Bank Human Resource - GRN

Gene ID NCBI Gene 2896 |  KEGG hsa:2896
Gene Symbol GRN
Protein Name granulin precursor
Synonyms CLN11|GEP|GP88|PCDGF|PEPI|PGRN
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004817 IRAK012A17 pCMV-SPORT6 BC010577 NM_002087 Full
HGY080559 IRAL001G15 pOTB7 BC000324 NM_001012479 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008291 W01A020M03 pENTR-TOPO flj0064h08 AK000607 NM_002087  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050884 ARe27D12 pKA1U5 NM_002087.2  
GGCTGCTGCCCAAGGCACCGNGGAGNCGGACGCNNGAAGACCATGTGGTACCCTGAGTGA
HKR066531 ARe66F11 pKA1U5 NM_002087.2  
GGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGNTGGACCCTGGTGAGC
HKR082402 ARf06A02 pKA1U5 NM_002087.2  
GGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCANACNATGNTGGACCCTGGTGAGCTGG
HKR173708 ARi34E12 pGCAP10 NM_002087.2  
GGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGTGGACCCTGGTGAGCT
HKR178075 ARi45D03 pGCAP10 NM_002087.2  
GGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGTGGACCCTGGTGAGCT
HKR276522 ARiS191F02 pGCAP10 NM_002087.2  
GGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGTGGACCCTGGTGAGCT
HKR475013 RBdS187I21 pGCAP10 NM_002087.2  
GGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGTGGACCCTGGTGAGCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl