Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187I21

Clone ID RBdS187I21
HP ID HP02428
Gene ID 2896
Gene Symbol GRN
Protein Name granulin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002087.2
Length of RefSeq (bp) 2323
Chromosome 17q21.32
Reference DDBJ accession
UniGene Hs.514220
5'-terminal sequence GGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAGACCATGTGGACCCTGGTGAGCTGGG
2011.08.28