Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GRK6

Gene ID (NCBI) 2870
Gene Symbol GRK6
Protein Name G protein-coupled receptor kinase 6
Synonyms GPRK6
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086332 IRAL015N20 pOTB7 BC009277 NM_002082 Full/var
HGY095720 IRAL039E24 pOTB7 BC017272 NM_002082 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056030 ARe40B06 pKA1U5 NM_002082.3  
GGGAGAGTGCGCGGCTGGCTGCGGCGGCCGGGGCAGGCNGGGGAGGCCGCGTNCNCGCTC
HKR378007 RBd45A07 pGCAP10 NM_002082.3  
GGCGCGGCTGGCTGCGGCGGCCGGGGAGGCCGGGGAGGCCGCGGCGCGGTCACTGCGAGC
HKR405898 RBdS014M10 pGCAP10 NM_002082.3  
GGCGCGGCTGGCTGCNGCGGCCGGGGAGGCCGGGGAGGCCGCGGCGCGGTCACTGCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl