Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014M10

Clone ID RBdS014M10
HP ID HP05406
Gene ID 2870
Gene Symbol GRK6
Protein Name G protein-coupled receptor kinase 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002082.3
Length of RefSeq (bp) 2952
Chromosome 5q35
Reference DDBJ accession
UniGene Hs.235116
5'-terminal sequence GGCGCGGCTGGCTGCNGCGGCCGGGGAGGCCGGGGAGGCCGCGGCGCGGTCACTGCGAGC
2011.08.28