Prev. |  KEGG KO K04548 > 

RIKEN DNA Bank Human Resource - GNGT1

Gene ID NCBI Gene 2792 |  KEGG hsa:2792
Gene Symbol GNGT1
Protein Name G protein subunit gamma transducin 1
Synonyms GNG1
Ortholog resources KEGG ortholog (KEGG orthology K04548) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096519 IRAL041E23 pDNR-LIB BC029367 NM_021955 Full
HGY096524 IRAL041F04 pDNR-LIB BC030956 NM_021955 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003793 W01A009I01 pENTR-TOPO IRAL041E23 BC029367 NM_021955  
HGE003795 W01A009I03 pENTR-TOPO IRAL041E23 BC029367 NM_021955  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366830 RBd17B06 pGCAP10 NM_021955.3  
GTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAAACAAAGAACAGTTTACTTTCA
HKR395305 RBd88E09 pGCAP10 NM_021955.3  
GAGAATTGTTAAGAGAGAGAGCTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAA
HKR396978 RBd92H10 pGCAP10 NM_021955.3  
AATGATTTCATTGGCTAGTGTGCATTGCTAGAATTGTTAAGAGAGAGAGCTCATATGAAA
HKR405564 RBdS013P04 pGCAP10 NM_021955.3  
TGAATTGTTAAGAGAGAGAGCTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAAA
HKR432752 RBdS081O16 pGCAP10 NM_021955.3  
GAGAATTGTTAAGAGAGAGAGCTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAA
HKR452826 RBdS132B02 pGCAP10 NM_021955.3  
TGATCGTGGGATATTTAAAATAAAACAAAGAACAGTTTACTTTGTAAGTTAAGAGCTGAG
HKR461606 RBdS154A06 pGCAP10 NM_021955.3  
GAGAATTGTTAAGAGAGAGAGCTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl