Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132B02

Clone ID RBdS132B02
HP ID HP07212
Gene ID 2792
Gene Symbol GNGT1
Protein Name guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_021955.3
Length of RefSeq (bp) 628
Chromosome 7q21.3
Reference DDBJ accession
UniGene Hs.702084
5'-terminal sequence TGATCGTGGGATATTTAAAATAAAACAAAGAACAGTTTACTTTGTAAGTTAAGAGCTGAG
2011.08.28