Prev. |  KEGG KO K04542 > 

RIKEN DNA Bank Human Resource - GNG5

Gene ID NCBI Gene 2787 |  KEGG hsa:2787
Gene Symbol GNG5
Protein Name G protein subunit gamma 5
Synonyms -
Ortholog resource in our bank

  GNG5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082486 IRAL006D14 pOTB7 BC003563 NM_005274 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024411 W01A061A11 pENTR-TOPO IRAL006D14 BC003563 NM_005274  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049254 ARe23C06 pKA1U5 NM_005274.1  
GGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACCGACCCACGAATCGGCC
HKR060884 ARe52D12 pKA1U5 NM_005274.1  
GGCCGCTGATTTGTCTGGCCCCGNCCTTACCCACACTCCTAAGACCCACCGANCCANGAA
HKR218112 ARiS045E16 pGCAP10 NM_005274.1  
GAAANNNTNGNAGCCCCGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCA
HKR218147 ARiS045G03 pGCAP10 NM_005274.1  
TGACCGACCCACGAATCGGCCCGGCCGTCGCGTGCACCATGTCTGGCTCCTCCAGCGTCG
HKR264643 ARiS161K03 pGCAP10 NM_005274.1  
GGCCGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACCGACCCACGAATCG
HKR323656 RBb09C08 pKA1U5 NM_005274.1  
GGTTCGGAGCCCCGCCCCCGCCGCGCGCCGCTGAGTTTGTCTGGCCCGGCCGACCCACGG
HKR329259 RBb23C11 pGCAP1 NM_005274.1  
GCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACCGT
HKR337747 RBb44G03 pGCAP1 NM_005274.1  
GGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACC
HKR337772 RBb44H04 pGCAP1 NM_005274.1  
GGCCCCCGCCGCGCGCCGCTGTAGTTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCA
HKR344906 RBb62E10 pGCAP1 NM_005274.1  
GGCGCCGCTGAGTTGNCNGGCCCGGCCGACCCACGGNCCACCANTTANNGNACCCACGAA
HKR380454 RBd51C06 pGCAP10 NM_005274.1  
GGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACC
HKR396811 RBd92A11 pGCAP10 NM_005274.1  
GGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACCGACCCACGAATCGGCC
HKR405895 RBdS014M07 pGCAP10 NM_005274.1  
GCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACGGCCCACGACCCACCGAC
HKR405954 RBdS014O18 pGCAP10 NM_005274.1  
AGGAAGGGGAGCCCCGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACG
HKR406021 RBdS015A21 pGCAP10 NM_005274.1  
AGGAAGGGGAGCCCCGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACG
HKR420411 RBdS051A11 pGCAP10 NM_005274.1  
CGGCCGGCCGATGCCACGACCCACCGACCCACGAATCGGCCCGGCCGTCGCGTGCACCAT
HKR420451 RBdS051C03 pGCAP10 NM_005274.1  
CGGCCGGCCGATGCCACGACCCACCGACCCACGAATCGGCCCGGCCGTCGCGTGCACCAT
HKR433509 RBdS083M21 pGCAP10 NM_005274.1  
GGCTGAGCACAGAACCGGAAACTTAGAGACAAAGTTCGGAGCCCCGCCCCCGCCGCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl