Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014O18

Clone ID RBdS014O18
HP ID HP00634
Gene ID 2787
Gene Symbol GNG5
Protein Name guanine nucleotide binding protein (G protein), gamma 5
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005274.1
Length of RefSeq (bp) 698
Chromosome 1p22
Reference DDBJ accession
UniGene Hs.645427
5'-terminal sequence AGGAAGGGGAGCCCCGCCCCCGCCGCGCGCCGCTGAGTTGTCTGGCCCCGCCGACCCACG
2011.08.28