Prev. |  KEGG KO K17255 > 

RIKEN DNA Bank Human Resource - GDI2

Gene ID NCBI Gene 2665 |  KEGG hsa:2665
Gene Symbol GDI2
Protein Name GDP dissociation inhibitor 2
Synonyms HEL-S-46e|RABGDIB
Ortholog resources KEGG ortholog (KEGG orthology K17255) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083107 IRAL007M19 pOTB7 BC005145 NM_001494 Full
HGY092698 IRAL031M10 pDNR-LIB BC024168 NM_001494 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041348 ARe03G04 pKA1U5 NM_001494.3  
AGTTCTTCTCTTCCCGTCTGAGGTGGCGGTCGGNCTNGCCTTGTCGCCAGCTCCATTTTC
HKR043635 ARe09B11 pKA1U5 NM_001494.3  
GGCCCAGATTCTTCTCTTCCCGTCTGAGGTGGCGGCTCGGATCTCGCCTTGTCGCCAGCT
HKR178456 ARi46C08 pGCAP10 NM_001494.3  
GGCCAGCTCCATTTTCCTCTCTTTCTCTTCCCCTTTCCTTCGCGCCCAAGAGCGCCTCCC
HKR234118 ARiS085E22 pGCAP10 NM_001494.3  
GGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTTCCTCTCTTTCTCTTCCCCTTTCCT
HKR338123 RBb45F03 pGCAP1 NM_001494.3  
GCTTCTCTTCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTTCCTC
HKR345680 RBb64D08 pGCAP1 NM_001494.3  
ATGTTCTCTTCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTTCCT
HKR375327 RBd38F07 pGCAP10 NM_001494.3  
TGAGTTCTTCTCTTCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTT
HKR381254 RBd53C06 pGCAP10 NM_001494.3  
GCTTCTCTTCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGNNNGCTCCATTTTCCTC
HKR384477 RBd61D05 pGCAP10 NM_001494.3  
GAGTTCTTCTCTTCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTT
HKR387274 RBd68D02 pGCAP10 NM_001494.3  
GCTTCTCTTCCCGTCTGAGGNGGCGGTCGGTCTCNCCTTGTCGCCNGCTCCATTTTCCTC
HKR405385 RBdS013H17 pGCAP10 NM_001494.3  
TGGTCGCCTTGTCGCCANCTCCATTTTCCTCTCTTTCTCTTCCCCTTTCCTTCGCGCCCA
HKR474951 RBdS187G07 pGCAP10 NM_001494.3  
GCTCTNCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTTCCTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl