Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187G07

Clone ID RBdS187G07
HP ID HP00590
Gene ID 2665
Gene Symbol GDI2
Protein Name GDP dissociation inhibitor 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001494.3
Length of RefSeq (bp) 2441
Chromosome 10p15
Reference DDBJ accession
UniGene Hs.299055
5'-terminal sequence GCTCTNCCCGTCTGAGGTGGCGGTCGGTCTCGCCTTGTCGCCAGCTCCATTTTCCTCTCT
2011.08.28