Prev. |  KEGG KO K00725 > 

RIKEN DNA Bank Human Resource - B4GALNT1

Gene ID NCBI Gene 2583 |  KEGG hsa:2583
Gene Symbol B4GALNT1
Protein Name beta-1,4-N-acetyl-galactosaminyltransferase 1
Synonyms GALGT|GALNACT|GalNAc-T|SPG26
Ortholog resources KEGG ortholog (KEGG orthology K00725) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14009 pENTR/B4GALNT1 Entry vector of human B4GALNT1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020697 IRAK051M09 pCMV-SPORT6 BC029828 NM_001478 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR329631 RBb24B07 pGCAP1 NM_001478.3  
GGAGCCGCGCTGCGCTGCGGTGCGAAGAGCCGGGCGGCGGCCAGAGCCCTCCCCGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.07.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl