DNA Bank Top |  KEGG KO K00725 > 

RIKEN DNA Bank Human Resource - B4GALNT1

Gene ID NCBI Gene 2583 |  KEGG hsa:2583
Gene Symbol B4GALNT1
Protein Name beta-1,4-N-acetyl-galactosaminyltransferase 1
Synonyms GALGT|GALNACT|GalNAc-T|SPG26

Link

Ortholog resource in our bank

  B4GALNT1


External database

human B4GALNT1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14009 pENTR/B4GALNT1 Entry vector of human B4GALNT1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020697 IRAK051M09 pCMV-SPORT6 BC029828 NM_001478 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329631 RBb24B07 pGCAP1 NM_001478.3  
GGAGCCGCGCTGCGCTGCGGTGCGAAGAGCCGGGCGGCGGCCAGAGCCCTCCCCGCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl