Prev. |  Human A to Z list >  B >  B4GALNT1 > 

RBb24B07 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR329631
Clone Name RBb24B07
Clone info. Plasmid clone of human B4GALNT1 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GGAGCCGCGCTGCGCTGCGGTGCGAAGAGCCGGGCGGCGGCCAGAGCCCTCCCCGCGCTG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001478.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) B4GALNT1 (NCBI Gene 2583)  other clone of B4GALNT1 in our bank
Synonyms GALGT|GALNACT|GalNAc-T|SPG26
Protein Name beta-1,4-N-acetyl-galactosaminyltransferase 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR329631 RBb24B07 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.05

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl