Prev. |  KEGG KO K00036 > 

RIKEN DNA Bank Human Resource - G6PD

Gene ID NCBI Gene 2539 |  KEGG hsa:2539
Gene Symbol G6PD
Protein Name glucose-6-phosphate dehydrogenase
Synonyms G6PD1
Ortholog resource in our bank

  G6PD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080613 IRAL001I21 pOTB7 BC000337 NM_000402 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099618 M01C049A18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099666 M01C049C18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099714 M01C049E18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099762 M01C049G18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099810 M01C049I18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099858 M01C049K18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099906 M01C049M18 pDONR221 MGC14-B09 BC000337 ENST00000369624  
HGE099954 M01C049O18 pDONR221 MGC14-B09 BC000337 ENST00000369624  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364078 RBd10D06 pGCAP10 NM_000402.3  
GGGAAACGGTCGTACACTTCGGGGCTGCGAGCGCGGAGGGCGACGACGACGAAGCGCAGA
HKR405315 RBdS013E19 pGCAP10 NM_000402.3  
GGCTGCGAGCGCGGAGGGCGACGACGACGAAGCGCAGACAGCGTCATGGCAGAGCAGGTG
HKR433389 RBdS083H21 pGCAP10 NM_000402.3  
GGGGGCTGCGAGCGCGGAGGGCGACGACGACGAAGCGCAGACAGCGTCATGGCAGAGCAG
HKR452928 RBdS132F08 pGCAP10 NM_000402.3  
GGAGGGGTGGTGGCCGAGGCCCCGCCCCGCACGCCTCGCCTGAGGCGGGTCCGCTCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl