Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083H21

Clone ID RBdS083H21
HP ID HP06977
Gene ID 2539
Gene Symbol G6PD
Protein Name glucose-6-phosphate dehydrogenase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000402.3
Length of RefSeq (bp) 2395
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.461047
5'-terminal sequence GGGGGCTGCGAGCGCGGAGGGCGACGACGACGAAGCGCAGACAGCGTCATGGCAGAGCAG
2011.08.28