Prev. |  KEGG KO K01206 > 

RIKEN DNA Bank Human Resource - FUCA1

Gene ID NCBI Gene 2517 |  KEGG hsa:2517
Gene Symbol FUCA1
Protein Name alpha-L-fucosidase 1
Synonyms FUCA
Ortholog resources KEGG ortholog (KEGG orthology K01206) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095773 IRAL039H05 pOTB7 BC017338 NM_000147 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078478 ARe96D06 pKA1U5 NM_000147.3  
GCCCCCGCGGGCACCTGCGCGTTAAGAGTGGGCCGCGNTCGCTGAGGGGTAGCGATGCGG
HKR170435 ARi26B11 pGCAP10 NM_000147.3  
GAGCGATGCGGGCTCCGGGGATGAGGTCGCGGCCGGCGGGTCCCGCGCTGTTGCTGCTGC
HKR174831 ARi37B07 pGCAP10 NM_000147.3  
GGTGGGCCGCGTCGCTGAGGGGTAGCGATGCGGGCTCCGGGGATGAGGTCGCGGCCGGCG
HKR461962 RBdS154P02 pGCAP10 NM_000147.3  
GAGCGATGCGGGCTCCGGGGATGAGGTCGCGGCCGGCGGGTCCCGCGCTGTTGCTGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl